miRBase entry: bmo-let-7

Stem-loop bmo-let-7


Accession
MI0004968
Description
Bombyx mori bmo-let-7 precursor miRNA

Literature search
11 open access papers mention bmo-let-7
(167 sentences)

Sequence

99443 reads, 17641 reads per million, 3 experiments
gguacugccgucggcuuguUGAGGUAGUAGGUUGUAUAGUacggaaauacaacacauaggugcgaCUGUAUAGCCUGCUAACUUUCCgagcugacggaaugaca
.((....(((((((((((..(((.((((((((((((((((.((.(..((.......))..).)))))))))))))))))).)))..)))))))))))....)).

Structure
g  acug           uU   G                a  g aa  ca 
 gu    ccgucggcuug  GAG UAGUAGGUUGUAUAGU cg a  ua  a
 ||    |||||||||||  ||| |||||||||||||||| || |  ||  c
 ca    ggcagucgagC  UUC AUCGUCCGAUAUGUCa gc u  au  a
a  guaa           CU   A                -  g gg  ac 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
NW_004582019.1: 3373685-3373788 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from bmo-let-7
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bmo-let-7-5p

Accession MIMAT0004190
Description Bombyx mori bmo-let-7-5p mature miRNA
Sequence 20 - UGAGGUAGUAGGUUGUAUAGU - 40
Evidence experimental
Northern [1-3], RT-PCR [4], Illumina [5]
Database links

Mature bmo-let-7-3p

Accession MIMAT0015221
Description Bombyx mori bmo-let-7-3p mature miRNA
Sequence 66 - CUGUAUAGCCUGCUAACUUUCC - 87
Evidence experimental
Illumina [5]
Database links

References

  1. PubMed ID: 16972323
    Computational prediction of microRNA genes in silkworm genome
    "Tong CZ, Jin YF, Zhang YZ"
    "J Zhejiang Univ Sci B (2006) 7:806-816

  2. PubMed ID: 17651473
    Characterization and expression patterns of let-7 microRNA in the silkworm (Bombyx mori)
    Liu S, Xia Q, Zhao P, Cheng T, Hong K, Xiang Z
    BMC Dev Biol (2007) 7:88

  3. PubMed ID: 18507836
    Identification and characteristics of microRNAs from Bombyx mori
    He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y
    BMC Genomics (2008) 9:248

  4. PubMed ID: 18977439
    Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system
    "Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y"
    "Insect Biochem Mol Biol (2008) 38:1066-1071

  5. PubMed ID: 20199675
    MicroRNAs of Bombyx mori identified by Solexa sequencing
    Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q
    BMC Genomics (2010) 11:148