miRBase entry: hsa-mir-125b-2

Stem-loop hsa-mir-125b-2


Accession
MI0000470
Symbol
HGNC: MIR125B2
Description
Homo sapiens hsa-mir-125b-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR125B2 is a microRNA gene implicated in the genetic investigation of anterior cruciate ligament (ACL) rupture due to its potential pathogenicity and shared biology with other associated genes [PMC9536556]. Single nucleotide polymorphisms (SNPs) in the genomic DNA of offspring were utilized to determine the imprinting status of MIR125B2, indicating its potential involvement in genetic inheritance patterns [PMC10014956]. The gene was selected among others for its relevance to ACL rupture, based on shared regions in affected family members, previously published associations, and common biological functions [PMC9536556].

Literature search
687 open access papers mention hsa-mir-125b-2
(4255 sentences)

Sequence

811478 reads, 3711 reads per million, 154 experiments
accagacuuuuccuagUCCCUGAGACCCUAACUUGUGAgguauuuuaguaacaUCACAAGUCAGGCUCUUGGGACcuaggcggagggga
.((...((((.(((((((((.((((.(((.((((((((.((.........)).)))))))).))).)))))))).))))).)))).)).

Structure
a  aga    u     -    U    C   A        g  auu 
 cc   cuuu ccuag UCCC GAGA CCU ACUUGUGA gu   u
 ||   |||| ||||| |||| |||| ||| |||||||| ||   u
 gg   gagg ggauc AGGG UUCU GGA UGAACACU ca   a
a  --g    c     C    -    C   C        a  aug 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context
chr21: 16590237-16590325 [+]

Disease association
hsa-mir-125b-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-125b-5p

Accession MIMAT0000423
Description Homo sapiens hsa-miR-125b-5p mature miRNA
Sequence 17 - UCCCUGAGACCCUAACUUGUGA - 38
Evidence experimental
cloned [2,4-6], Illumina [7]
Database links
Predicted targets

Mature hsa-miR-125b-2-3p

Accession MIMAT0004603
Description Homo sapiens hsa-miR-125b-2-3p mature miRNA
Sequence 54 - UCACAAGUCAGGCUCUUGGGAC - 75
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  6. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575

  7. PubMed ID: 15722555
    Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation
    "Lee YS, Kim HK, Chung S, Kim KS, Dutta A"
    "J Biol Chem (2005) 280:16635-16641