Accession | MIMAT0000423 |
Description | hsa-miR-125b-5p mature miRNA |
Hairpins | |
Sequence | UCCCUGAGACCCUAACUUGUGA |
Evidence |
experimental
cloned [2,4-6], Illumina [7] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:28214897 | occurs_in CL:0002540 |
acts_upstream_of | GO:0010804 negative regulation of tumor necrosis factor-mediated signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26435691 | |
acts_upstream_of | GO:0010839 negative regulation of keratinocyte proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21412257 | |
acts_upstream_of | GO:0030514 negative regulation of BMP signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28214897 | occurs_in CL:0002540 |
acts_upstream_of | GO:0045618 positive regulation of keratinocyte differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21412257 | |
acts_upstream_of | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28214897 | occurs_in CL:0002540 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28214897 | has_input UniProtKB:O00238 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19437538 | has_input UniProtKB:P11473 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21412257 | has_input UniProtKB:P21802 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22391569 | has_input UniProtKB:P33151 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26435691 | has_input UniProtKB:P01375 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26455324 | has_input UniProtKB:P08887 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28214897 | has_input UniProtKB:O00238 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28389358 | has_input UniProtKB:P07332 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30237497 | has_input UniProtKB:P09603 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30237497 | has_input UniProtKB:P78423 |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22391569 | occurs_in CL:0002618 |
involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26435691 | |
involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26435691 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19437538 | has_input UniProtKB:P11473 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:20347935 | has_input UniProtKB:P42771 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26435691 | has_input UniProtKB:P01375 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26455324 | has_input UniProtKB:P08887 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28389358 | has_input UniProtKB:P07332 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30237497 | has_input UniProtKB:P09603 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|