Stem-loop sequence bmo-mir-2757

AccessionMI0012311 (change log)
DescriptionBombyx mori miR-2757 stem-loop
Stem-loop
   -aau   ug            u     a  a   uuuu 
5'     uau  aaacgggaaugg cacuu ca cug    u
       |||  |||||||||||| ||||| || |||    u
3'     aua  uuugccuuuacc gugaa gu gau    c
   uauc   gu            u     a  c   cuuu 
Get sequence
Deep sequencing
551 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582009.1: 1928109-1928186 [-]
intergenic
Database links

Mature sequence bmo-miR-2757-5p

Accession MIMAT0013627
Previous IDsbmo-miR-2757
Sequence

11 - 

acgggaauggucacuuacaacu

 - 32

Get sequence
Deep sequencing448 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

Mature sequence bmo-miR-2757-3p

Accession MIMAT0013628
Previous IDsbmo-miR-2757*
Sequence

48 - 

cugaaaguguccauuuccguu

 - 68

Get sequence
Deep sequencing101 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).