Stem-loop sequence bmo-mir-11

AccessionMI0012294 (change log)
DescriptionBombyx mori miR-11 stem-loop
Gene family MIPF0000252; mir-11
Literature search

1 open access papers mention bmo-mir-11
(1 sentences)

Stem-loop
   ---  uu         c    -   a     cc    uuc 
5'    gu  uguggcuag acuc gac uguga  ugug   g
      ||  ||||||||| |||| ||| |||||  ||||   g
3'    cg  acaucgauc ugag cug acacu  acac   u
   gcg  gc         u    a   -     --    uaa 
Get sequence
Deep sequencing
6681 reads, 1e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581691.1: 1165065-1165140 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-11
bmo-mir-11NW_004581691.1: 1165065-1165140 [+]
bmo-mir-998NW_004581691.1: 1166010-1166082 [+]
Database links

Mature sequence bmo-miR-11-5p

Accession MIMAT0013601
Previous IDsbmo-miR-11*
Sequence

11 - 

uagcacucgacaugugaccugu

 - 32

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]

Mature sequence bmo-miR-11-3p

Accession MIMAT0013602
Previous IDsbmo-miR-11
Sequence

45 - 

caucacagucagaguucuagcu

 - 66

Get sequence
Deep sequencing6669 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).