![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-bantam |
|||||
Accession | MI0008350 (change log) | ||||
Description | Bombyx mori bantam stem-loop | ||||
Gene family | MIPF0000153; bantam | ||||
Literature search |
![]()
12 open access papers mention bmo-bantam | ||||
Stem-loop |
uaaa uac c ga u u 5' aggaac gaaa ugguuuucauaaugauuu caga ug u |||||| |||| |||||||||||||||||| |||| || u 3' uccuug uuuu aucgaaaguguuacuaga gucu au u augg --- a -- u g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bmo-bantam-5p |
|
Accession | MIMAT0015278 |
Previous IDs | bmo-bantam* |
Sequence |
18 - cugguuuucauaaugauuugaca - 40 |
Deep sequencing | 12 reads, 2 experiments |
Evidence | experimental; Illumina [3] |
Mature sequence bmo-bantam-3p |
|
Accession | MIMAT0007907 |
Previous IDs | bmo-bantam |
Sequence |
56 - ugagaucauugugaaagcuaauu - 78 |
Deep sequencing | 13541 reads, 3 experiments |
Evidence | experimental; Northern [1], RT-PCR [2], Illumina [3] |
Database links |
|
References |
|
1 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
2 |
PMID:18977439
"Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
Insect Biochem Mol Biol. 38:1066-1071(2008).
|
3 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|