Stem-loop sequence bmo-bantam

Accession

MI0008350 (change log)

Description

Bombyx mori bantam stem-loop

Gene family

MIPF0000153; bantam

Literature search

12 open access papers mention bmo-bantam
(40 sentences)

Stem-loop

   uaaa      uac    c                  ga    u  u 
5'     aggaac   gaaa ugguuuucauaaugauuu  caga ug u
       ||||||   |||| ||||||||||||||||||  |||| || u
3'     uccuug   uuuu aucgaaaguguuacuaga  gucu au u
   augg      ---    a                  --    u  g 

Deep sequencing

13553 reads, 2.13e+03 reads per million, 3 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (ASM15162v1; GCA_000151625.1): NW_004582023.1: 2305314-2305403 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0008350

Mature sequence bmo-bantam-5p

• Accession: MIMAT0015278
• Previous IDs: bmo-bantam*
• Sequence: 18 - cugguuuucauaaugauuugaca - 40
• Deep sequencing: 12 reads, 2 experiments
• Evidence: experimental; Illumina [3]

Mature sequence bmo-bantam-3p

• Accession: MIMAT0007907
• Previous IDs: bmo-bantam
• Sequence: 56 - ugagaucauugugaaagcuaauu - 78
• Deep sequencing: 13541 reads, 3 experiments
• Evidence: experimental; Northern [1], RT-PCR [2], Illumina [3]
• Database links:
  • RNAcentral:URS00003B421B_7091

References

1. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2. PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
3. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).