Stem-loop sequence bmo-mir-2b

Accession

MI0008340 (change log)

Description

Bombyx mori miR-2b stem-loop

Gene family

MIPF0000049; mir-2

Literature search

11 open access papers mention bmo-mir-2b
(38 sentences)

Stem-loop

   c   -              -         c    ggg u 
5'  gcu agaacucgacaagg ugguuguga augg   c c
    ||| |||||||||||||| ||||||||| ||||   |  
3'  cgg ucuugaguuguuuc accgacacu uacu   g a
   u   c              g         a    --a g 

Deep sequencing

1685 reads, 133 reads per million, 3 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (ASM15162v1; GCA_000151625.1): NW_004582015.1: 7692030-7692105 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bmo-mir-2b

• bmo-mir-2a-1: NW_004582015.1: 7692561-7692650 [-]
• bmo-mir-13a: NW_004582015.1: 7692416-7692494 [-]
• bmo-mir-13b: NW_004582015.1: 7692288-7692367 [-]
• bmo-mir-2a-2: NW_004582015.1: 7692153-7692232 [-]
• bmo-mir-2b: NW_004582015.1: 7692030-7692105 [-]

Database links

• miRBase Tracker:MI0008340

Mature sequence bmo-miR-2b-5p

• Accession: MIMAT0015273
• Previous IDs: bmo-miR-2b*
• Sequence: 10 - ucgacaaggugguugugacaug - 31
• Deep sequencing: 74 reads, 3 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS000022AFA1_7091

Mature sequence bmo-miR-2b-3p

• Accession: MIMAT0007895
• Previous IDs: bmo-miR-2b
• Sequence: 46 - uaucacagccagcuuuguugagu - 68
• Deep sequencing: 1611 reads, 3 experiments
• Evidence: experimental; Northern [1], Illumina [2]
• Database links:
  • RNAcentral:URS000036FEAC_7091

References

1. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
2. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).