Stem-loop sequence bmo-mir-307

AccessionMI0004986 (change log)
DescriptionBombyx mori miR-307 stem-loop
Gene family MIPF0000293; mir-67
Literature search

5 open access papers mention bmo-mir-307
(13 sentences)

Stem-loop 
   a      ucc    ua         ccu  g       u  ---   c 
5'  gcucgu   cggu  cucacucaa   gg ugugaug gu   gca u
    ||||||   ||||  |||||||||   || ||||||| ||   ||| c
3'  cgagua   gcua  gagugaguu   cc acacuac cg   cgu g
   c      ucu    gc         ccu  a       c  gcu   u
Get sequence
Deep sequencing
60 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582026.1: 4749629-4749724 [-]
intergenic
Database links

Mature sequence bmo-miR-307-5p

Accession MIMAT0015237
Previous IDsbmo-miR-307*
Sequence

16 -  

acucacucaaccugggugugaug

 - 38

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [4]

Mature sequence bmo-miR-307-3p

Accession MIMAT0004208
Previous IDsbmo-miR-307
Sequence

61 -  

ucacaaccuccuugagugag

 - 80

Get sequence
Deep sequencing59 reads, 3 experiments
Evidence experimental; RT-PCR [3], Illumina [4]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
4
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).