miRBase entry: bmo-mir-275

Stem-loop bmo-mir-275


Accession
MI0004979
Description
Bombyx mori bmo-mir-275 precursor miRNA
Gene family
MIPF0000187; mir-275

Literature search
10 open access papers mention bmo-mir-275
(82 sentences)

Sequence

9650 reads, 1813 reads per million, 3 experiments
caggcggcagcgccgCGCGCUACUCCGGCGCCAGGACUguccucaccgagUCAGGUACCUGAAGUAGCGCGCGgugucuccuccua
.(((.((..((((((((((((((((.((.(((..((((..........)))).))).)).).)))))))))))))))..)).))).

Structure
c   c  ca               - C  C   AG    gucc 
 agg gg  gcgccgCGCGCUACU C GG GCC  GACU    u
 ||| ||  ||||||||||||||| | || |||  ||||     
 ucc cc  ugugGCGCGCGAUGA G CC UGG  CUga    c
a   u  uc               A U  A   -A    gcca 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
NW_004582013.1: 1926698-1926783 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from bmo-mir-275
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bmo-miR-275-5p

Accession MIMAT0015231
Description Bombyx mori bmo-miR-275-5p mature miRNA
Sequence 16 - CGCGCUACUCCGGCGCCAGGACU - 38
Evidence experimental
Illumina [5]

Mature bmo-miR-275-3p

Accession MIMAT0004201
Description Bombyx mori bmo-miR-275-3p mature miRNA
Sequence 51 - UCAGGUACCUGAAGUAGCGCGCG - 73
Evidence experimental
cloned [3], RT-PCR [4], Illumina [5]
Database links

References

  1. PubMed ID: 16972323
    Computational prediction of microRNA genes in silkworm genome
    "Tong CZ, Jin YF, Zhang YZ"
    "J Zhejiang Univ Sci B (2006) 7:806-816

  2. PubMed ID: 18507836
    Identification and characteristics of microRNAs from Bombyx mori
    He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y
    BMC Genomics (2008) 9:248

  3. PubMed ID: 18977439
    Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system
    "Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y"
    "Insect Biochem Mol Biol (2008) 38:1066-1071

  4. PubMed ID: 20199675
    MicroRNAs of Bombyx mori identified by Solexa sequencing
    Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q
    BMC Genomics (2010) 11:148

  5. PubMed ID: 18714353
    The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages
    Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J
    PLoS One (2008) 3:e2997