Stem-loop sequence bmo-mir-275

AccessionMI0004979 (change log)
DescriptionBombyx mori miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

10 open access papers mention bmo-mir-275
(80 sentences)

Stem-loop 
   c   c  ca               - c  cg  ag    gucc 
5'  agg gg  gcgccgcgcgcuacu c gg  cc  gacu    u
    ||| ||  ||||||||||||||| | ||  ||  ||||     
3'  ucc cc  uguggcgcgcgauga g cc  gg  cuga    c
   a   u  uc               a u  au  -a    gcca
Get sequence
Deep sequencing
10195 reads, 1.73e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582013.1: 1926698-1926783 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-275
bmo-mir-275NW_004582013.1: 1926698-1926783 [+]
bmo-mir-305NW_004582013.1: 1926822-1926912 [+]
Database links

Mature sequence bmo-miR-275-5p

Accession MIMAT0015231
Previous IDsbmo-miR-275*
Sequence

16 -  

cgcgcuacuccggcgccaggacu

 - 38

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [5]

Mature sequence bmo-miR-275-3p

Accession MIMAT0004201
Previous IDsbmo-miR-275
Sequence

51 -  

ucagguaccugaaguagcgcgcg

 - 73

Get sequence
Deep sequencing10191 reads, 3 experiments
Evidence experimental; cloned [3], RT-PCR [4], Illumina [5]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).