Stem-loop sequence bmo-mir-9a

AccessionMI0004972 (change log)
Previous IDsbmo-mir-9
DescriptionBombyx mori miR-9a stem-loop
Gene family MIPF0000014; mir-9
Literature search

8 open access papers mention bmo-mir-9a
(29 sentences)

Stem-loop 
   a      u   uaa   u       u        g     -  au 
5'  guagau ggu   uua cuuuggu aucuagcu uauga gu  u
    |||||| |||   ||| ||||||| |||||||| ||||| ||  a
3'  caucug ccg   aau gaggcca uggaucga auacu ca  c
   a      -   -ug   u       u        a     g  gu
Get sequence
Deep sequencing
2907 reads, 300 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582229.1: 9274-9363 [-]
intergenic
Database links

Mature sequence bmo-miR-9a-5p

Accession MIMAT0004194
Previous IDsbmo-miR-9;bmo-miR-9a
Sequence

18 -  

ucuuugguuaucuagcuguauga

 - 40

Get sequence
Deep sequencing2780 reads, 3 experiments
Evidence experimental; Northern [2], cloned [3], RT-PCR [4], Illumina [5]
Database links

Mature sequence bmo-miR-9a-3p

Accession MIMAT0015225
Previous IDsbmo-miR-9a*
Sequence

55 -  

auaaagcuagguuaccggaguua

 - 77

Get sequence
Deep sequencing127 reads, 3 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).