Stem-loop sequence bmo-mir-8

AccessionMI0004971 (change log)
DescriptionBombyx mori miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

9 open access papers mention bmo-mir-8
(25 sentences)

Stem-loop 
   c    ---c     aa   uu  -      -   g     c       uccug 
5'  acga    ggagu  cgg  cg caucuu acc ggcag auuagag     u
    ||||    |||||  |||  || |||||| ||| ||||| |||||||     c
3'  ugcu    ccucg  gcc  gc guagaa ugg cuguc uaaucuu     u
   c    ugca     -c   -u  u      a   a     a       uuaua
Get sequence
Deep sequencing
30451 reads, 4.8e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582017.1: 79866-79967 [+]
intergenic
Database links

Mature sequence bmo-miR-8-5p

Accession MIMAT0015224
Previous IDsbmo-miR-8*
Sequence

21 -  

caucuuaccgggcagcauuaga

 - 42

Get sequence
Deep sequencing7667 reads, 3 experiments
Evidence experimental; Illumina [5]
Database links

Mature sequence bmo-miR-8-3p

Accession MIMAT0004193
Previous IDsbmo-miR-8
Sequence

60 -  

uaauacugucagguaaagauguc

 - 82

Get sequence
Deep sequencing22779 reads, 3 experiments
Evidence experimental; Northern [2], cloned [3], RT-PCR [4], Illumina [5]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).