miRBase entry: bmo-mir-7

Stem-loop bmo-mir-7


Accession
MI0004970
Description
Bombyx mori bmo-mir-7 precursor miRNA
Gene family
MIPF0000022; mir-7

Literature search
6 open access papers mention bmo-mir-7
(16 sentences)

Sequence

3799 reads, 719 reads per million, 3 experiments
cgcuucguguuguaUGGAAGACUAGUGAUUUUGUUGUuuuuguugacuaacAAGAAAUCACUAAUCUGCCUAcaaagcgacagca
.(((((((.(((((.((.(((.((((((((((((((((......))).))))..))))))))).))).))))))).)))).))).

Structure
c   -    g     U  A   C         --    -   uu 
 gcu ucgu uugua GG AGA UAGUGAUUU  UGUU GUu  u
 ||| |||| ||||| || ||| |||||||||  |||| |||   
 cga agcg aacAU CC UCU AUCACUAAA  Acaa cag  g
a   c    a     -  G   A         GA    u   uu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
NW_004582035.1: 2817062-2817146 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from bmo-mir-7
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bmo-miR-7-5p

Accession MIMAT0004192
Description Bombyx mori bmo-miR-7-5p mature miRNA
Sequence 15 - UGGAAGACUAGUGAUUUUGUUGU - 37
Evidence experimental
cloned [3], RT-PCR [4], Illumina [5]
Database links

Mature bmo-miR-7-3p

Accession MIMAT0015223
Description Bombyx mori bmo-miR-7-3p mature miRNA
Sequence 52 - AAGAAAUCACUAAUCUGCCUA - 72
Evidence experimental
Illumina [5]

References

  1. PubMed ID: 16972323
    Computational prediction of microRNA genes in silkworm genome
    "Tong CZ, Jin YF, Zhang YZ"
    "J Zhejiang Univ Sci B (2006) 7:806-816

  2. PubMed ID: 18507836
    Identification and characteristics of microRNAs from Bombyx mori
    He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y
    BMC Genomics (2008) 9:248

  3. PubMed ID: 18977439
    Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system
    "Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y"
    "Insect Biochem Mol Biol (2008) 38:1066-1071

  4. PubMed ID: 20199675
    MicroRNAs of Bombyx mori identified by Solexa sequencing
    Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q
    BMC Genomics (2010) 11:148

  5. PubMed ID: 18714353
    The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages
    Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J
    PLoS One (2008) 3:e2997