![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-7 |
||||||
Accession | MI0004970 (change log) | |||||
Description | Bombyx mori miR-7 stem-loop | |||||
Gene family | MIPF0000022; mir-7 | |||||
Literature search |
![]()
6 open access papers mention bmo-mir-7 | |||||
Stem-loop |
c - g u a c -- - uu 5' gcu ucgu uugua gg aga uagugauuu uguu guu u ||| |||| ||||| || ||| ||||||||| |||| ||| 3' cga agcg aacau cc ucu aucacuaaa acaa cag g a c a - g a ga u uu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bmo-miR-7-5p |
|
Accession | MIMAT0004192 |
Previous IDs | bmo-miR-7 |
Sequence |
15 - uggaagacuagugauuuuguugu - 37 |
Deep sequencing | 4062 reads, 3 experiments |
Evidence | experimental; cloned [3], RT-PCR [4], Illumina [5] |
Database links |
|
Mature sequence bmo-miR-7-3p |
|
Accession | MIMAT0015223 |
Previous IDs | bmo-miR-7* |
Sequence |
52 - aagaaaucacuaaucugccua - 72 |
Deep sequencing | 3 reads, 2 experiments |
Evidence | experimental; Illumina [5] |
References |
|
1 |
PMID:16972323
"Computational prediction of microRNA genes in silkworm genome"
J Zhejiang Univ Sci B. 7:806-816(2006).
|
2 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
3 |
PMID:18714353
"The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
PLoS One. 3:e2997(2008).
|
4 |
PMID:18977439
"Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
Insect Biochem Mol Biol. 38:1066-1071(2008).
|
5 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|