![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-15a |
||||||
Accession | MI0001186 (change log) | |||||
Description | Gallus gallus miR-15a stem-loop | |||||
Gene family | MIPF0000006; mir-15 | |||||
Literature search |
![]()
17 open access papers mention gga-mir-15a | |||||
Stem-loop |
gcauaac ua ua gggu g 5' ccuug g gcagcaca augguuugu uuu a ||||| | |||||||| ||||||||| ||| 3' ggaac c cgucgugu uaccggacg gga a auaaaaa uc ua ---u a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence gga-miR-15a |
|
Accession | MIMAT0001117 |
Sequence |
14 - uagcagcacauaaugguuugu - 34 |
Deep sequencing | 12994 reads, 5 experiments |
Evidence | experimental; cloned [2-3], Northern [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15592404
"Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
Nature. 432:695-716(2004).
|
2 |
PMID:16750530
"Identification of microRNAs from different tissues of chicken embryo and adult chicken"
FEBS Lett. 580:3610-3616(2006).
|
3 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
4 |
"
Unpublished.
|
5 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|