Stem-loop sequence gga-mir-15a

AccessionMI0001186 (change log)
DescriptionGallus gallus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

17 open access papers mention gga-mir-15a
(154 sentences)

Stem-loop 
        gcauaac ua        ua         gggu   g 
5' ccuug       g  gcagcaca  augguuugu    uuu a
   |||||       |  ||||||||  |||||||||    |||  
3' ggaac       c  cgucgugu  uaccggacg    gga a
        auaaaaa uc        ua         ---u   a
Get sequence
Deep sequencing
13018 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 169399193-169399275 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-15a
gga-mir-15achr1: 169399193-169399275 [-]
gga-mir-16-1chr1: 169399051-169399134 [-]
Database links

Mature sequence gga-miR-15a

Accession MIMAT0001117
Sequence

14 -  

uagcagcacauaaugguuugu

 - 34

Get sequence
Deep sequencing12994 reads, 5 experiments
Evidence experimental; cloned [2-3], Northern [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
" McBride D, Carre W, Law A, Clinton M Unpublished.
5
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).