miRBase entry: gma-MIR1509b

Stem-loop gma-MIR1509b


Accession
MI0010730
Description
Glycine max gma-MIR1509b precursor miRNA

Literature search
13 open access papers mention gma-MIR1509b
(27 sentences)

Sequence


cugcaucuuuUUAAUCAAGGAAAUCACGGUUgagugugaaggagagaaaguggcuucagauuuccggguuuuccuucuccacuguguuuccuugguuaaagauaugugc
..((((.((((((((((((((((.((((((.((....(((((((((....(((..........)))..))))))))))).)))))))))))))))))))))).))))..

Structure
cu    c                U      U  gugu         aaag   cuuc 
  gcau uuuUUAAUCAAGGAAA CACGGU ga    gaaggagag    ugg    a
  |||| |||||||||||||||| |||||| ||    |||||||||    |||     
  ugua agaaauugguuccuuu guguca cu    cuuccuuuu    gcc    g
cg    u                -      c  ----         --gg   uuua 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr5: 1350441-1350549 [+]

Database links

Mature gma-miR1509b

Accession MIMAT0011201
Description Glycine max gma-miR1509b mature miRNA
Sequence 11 - UUAAUCAAGGAAAUCACGGUU - 31
Evidence experimental
cloned [1], Illumina [2,4-5], 454 [3]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14

  2. PubMed ID: 19084500
    Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules
    "Wang Y, Li P, Cao X, Wang X, Zhang A, Li X"
    "Biochem Biophys Res Commun (2009) 378:799-803

  3. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  4. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  5. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153