Stem-loop vvi-MIR319c

Accession

MI0006549

Description

Vitis vinifera vvi-MIR319c precursor miRNA

Literature search

7 open access papers mention vvi-MIR319c
(27 sentences)

Sequence

6294 reads, 422 reads per million, 2 experiments

uuacauugaagagagcuuucuucaguccacucauggguggcaguaggauugaauuagcugccgacucauucauccaaauacuguguuaaggacuacccaguaaaugauugaaugaugcgggagacaaauuggaucuuaagcucccugugcUUGGACUGAAGGGAGCUCCCUucacugcaauc
...((.(((((.(((((((((((((((((..((((((.(((..(((((((.((((.(((.(((..(((((((..((..(((((.((........)).)))))..))..)))))))..))).)).).)))).))))))).))).))))))..))))))))))))))))).))))).)).....

Structure

--uua  u     a                 cu      u   ag       g    a -  g   ac       uc  aa     u  uaa 
     ca ugaag gagcuuucuucagucca  cauggg ggc  uaggauu aauu g cu ccg  ucauuca  ca  uacug gu   g
     || ||||| |||||||||||||||||  |||||| |||  ||||||| |||| | || |||  |||||||  ||  ||||| ||    
     gu acuUC CUCGAGGGAAGUCAGGU  gugucc ucg  auucuag uuaa c ga ggc  aguaagu  gu  augac ca   g
cuaac  c     C                 Uc      c   -a       g    a a  g   gu       ua  aa     c  uca 

Annotation confidence Not enough data

Genome context

chr2: 855561-855742 [-]

Mature vvi-miR319c

• Accession: MIMAT0005704
• Description: Vitis vinifera vvi-miR319c mature miRNA
• Sequence: 151 - UUGGACUGAAGGGAGCUCCCU - 171
• Evidence: experimental ; Array [2], Illumina [2]

References

1. PubMed ID: 17721507
   The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
   "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
   "Nature (2007) 449:463-467


2. PubMed ID: 19939267
   High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
   Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
   BMC Genomics (2009) 10:558