WARNING: This summary was generated by AI. MIR663A is a microRNA that plays a role in suppressing colorectal cancer (CC) metastasis [PMC6365692]. In contrast, the variant TTC22V1 is implicated in the promotion of CC metastasis [PMC6365692]. The downregulation of MIR663A by the long non-coding RNA MALAT1 has been a subject of study, particularly in relation to how it affects the expression of MIR663A target genes [PMC6113222]. However, the specific target genes listed in the original summary are incorrectly formatted and cannot be verified as MIR663A targets based on the provided reference. Therefore, the statement regarding these specific genes should be omitted until accurate gene names can be provided. The investigation of the expression changes of MIR663A target genes in HCT116 cells has been conducted to understand the significance of MIR663A's downregulation by MALAT1 [PMC6113222].
-ccuu c - -C G - ----- - ucg
ccgg guc ccAGG GG GCG CCGCGGGA CCGCc c u
|||| ||| ||||| || ||| |||||||| ||||| |
ggcc cgg ggucc uu ugc ggcgcccu ggcgg g g
guacc - u uu g c agggu u ucu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003326 |
| Description | Homo sapiens hsa-miR-663a mature miRNA |
| Sequence | 15 - AGGCGGGGCGCCGCGGGACCGC - 36 |
| Evidence |
experimental
SAGE [1] |
| Database links |
|
| Predicted targets |
|
|