| Accession | MIMAT0003326 |
| Description | hsa-miR-663a mature miRNA |
| Hairpins | |
| Sequence | AGGCGGGGCGCCGCGGGACCGC |
| Evidence |
experimental
SAGE [1] |
| Database links |
|
| Predicted targets |
|
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|