miRBase entry: dre-mir-20b-1

Stem-loop dre-mir-20b-1


Accession
MI0001899
Description
Danio rerio dre-mir-20b-1 precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Dre-mir-20b, a microRNA investigated in zebrafish embryos, has been associated with increased mortality and developmental abnormalities when present at a concentration of 4 µM [PMC6834413]. The study revealed that embryos in the 4 µM dre-mir-20b group exhibited a significantly higher mortality rate and a lower survival rate compared to the negative control (NC) group and wild-type counterparts [PMC6834413]. Additionally, the expression levels of fibroblast growth factor 2 (FGF2) and growth factor receptor-bound protein 2 (GRB2) mRNA were notably reduced in the dre-mir-20b group, suggesting that dre-mir-20b may negatively regulate these genes [PMC6834413]. Morphological examination under an optical microscope identified abnormalities in retinal structure, particularly sparse and irregularly arranged photoreceptor cells within the dre-mir-20b group [PMC6834413'>PMC6834413'>PMC6834413]. Furthermore, these embryos displayed more pronounced overall morphological defects including significantly smaller eye volumes [PMC6834413]. Immunofluorescence assays corroborated these findings by showing decreased protein expression levels of FGF2 and GRB2 in the photoreceptor cell layer of embryos affected by dre-mir-20b when compared to controls [PMC6834413]. The study's methodology involved injecting 4 µM dre-mir-20b mimics into zebrafish at the single-cell stage for subsequent analysis at an incubation temperature of 28.5°C [PMC6834413].

Literature search
17 open access papers mention dre-mir-20b-1
(20 sentences)

Sequence

159297 reads, 302.0 reads per million, 263 experiments
gaguuuguccuggcaguucCAAAGUGCUCACAGUGCAGGUAGUGccaguggaucuACUGCAAUGUCUGCACUUCAAGUauugccggacgccuuc
.....(((((.((((((....((((((..(((.(((((.(((..((...))..)))))))).)))..)))))).....))))))))))).....

Structure
gaguu     u      -ucCA      UC   G     G   UG  a 
     ugucc ggcagu     AAGUGC  ACA UGCAG UAG  cc  
     ||||| ||||||     ||||||  ||| ||||| |||  || g
     gcagg ccguua     UUCACG  UGU ACGUC Auc  gg  
cuucc     -      UGAAC      UC   A     -   ua  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 31467167-31467260 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from dre-mir-20b-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dre-miR-20b-5p

Accession MIMAT0001778
Description Danio rerio dre-miR-20b-5p mature miRNA
Sequence 20 - CAAAGUGCUCACAGUGCAGGUAGUG - 44
Evidence experimental
cloned [1]
Database links
Predicted targets

Mature dre-miR-20b-1-3p

Accession MIMAT0031939
Description Danio rerio dre-miR-20b-1-3p mature miRNA
Sequence 56 - ACUGCAAUGUCUGCACUUCAAGU - 78
Evidence not_experimental
Database links

References

  1. PubMed ID: 15937218
    The developmental miRNA profiles of zebrafish as determined by small RNA cloning
    "Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T"
    "Genes Dev (2005) 19:1288-1293