miRBase entry: hsa-mir-20b

Stem-loop hsa-mir-20b


Accession
MI0001519
Symbol
HGNC: MIR20B
Description
Homo sapiens hsa-mir-20b precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR20B is a microRNA that has been observed to have low expression in PC3 glioblastoma stem-like cells (GSCs) in comparison to PC1 and PC2 GSCs, indicating a potential role in glioblastoma cell differentiation or maintenance [PMC7463503]. In esophageal cancer cell lines, MIR20B transfection has been shown to influence autophagy, as evidenced by changes in autophagy markers LC3 and p62 [PMC5302951]. Furthermore, MIR20B is part of the miR‐106a‐363 cluster and its overexpression has demonstrated an anti-proliferative effect on cancer cells [PMC8410538]. In the context of breast cancer, upregulation of MIR20B has been associated with reduced metastasis to the lung, suggesting its function as a tumor suppressor miRNA [PMC7062679]. Additionally, genetic variations such as the rs13897515 polymorphism in the MIR20B gene have been linked with differences in amyloid beta levels in cerebrospinal fluid (CSF), which could have implications for Alzheimer's disease (AD) research [PMC9792503]. In individuals without the APOE ε4 allele, higher levels of MIR20B are correlated with a decreased likelihood of AD and an increased likelihood of no cognitive impairment (NCI) [PMC9054681].

Literature search
208 open access papers mention hsa-mir-20b
(659 sentences)

Sequence

12866 reads, 152 reads per million, 136 experiments
aguacCAAAGUGCUCAUAGUGCAGGUAGuuuuggcaugacucuACUGUAGUAUGGGCACUUCCAGuacu
(((((..(((((((((((.(((((..((((.......))))...))))).)))))))))))...)))))

Structure
     -CA           G     -GU    uu 
aguac   AAGUGCUCAUA UGCAG   AGuu  g
|||||   ||||||||||| |||||   ||||  g
ucauG   UUCACGGGUAU AUGUC   ucag  c
     ACC           G     Auc    ua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 134169809-134169877 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-20b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-20b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-20b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-20b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-20b-5p

Accession MIMAT0001413
Description Homo sapiens hsa-miR-20b-5p mature miRNA
Sequence 6 - CAAAGUGCUCAUAGUGCAGGUAG - 28
Evidence experimental
array-cloned [2], cloned [3-5]
Database links
Predicted targets

Mature hsa-miR-20b-3p

Accession MIMAT0004752
Description Homo sapiens hsa-miR-20b-3p mature miRNA
Sequence 44 - ACUGUAGUAUGGGCACUUCCAG - 65
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  5. PubMed ID: 15944709
    c-Myc-regulated microRNAs modulate E2F1 expression
    "O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT"
    "Nature (2005) 435:839-843