MIR20B is a microRNA that has been observed to have low expression in PC3 glioblastoma stem-like cells (GSCs) in comparison to PC1 and PC2 GSCs, indicating a potential role in glioblastoma cell differentiation or maintenance [PMC7463503]. In esophageal cancer cell lines, MIR20B transfection has been shown to influence autophagy, as evidenced by changes in autophagy markers LC3 and p62 [PMC5302951]. Furthermore, MIR20B is part of the miR‐106a‐363 cluster and its overexpression has demonstrated an anti-proliferative effect on cancer cells [PMC8410538]. In the context of breast cancer, upregulation of MIR20B has been associated with reduced metastasis to the lung, suggesting its function as a tumor suppressor miRNA [PMC7062679]. Additionally, genetic variations such as the rs13897515 polymorphism in the MIR20B gene have been linked with differences in amyloid beta levels in cerebrospinal fluid (CSF), which could have implications for Alzheimer's disease (AD) research [PMC9792503]. In individuals without the APOE ε4 allele, higher levels of MIR20B are correlated with a decreased likelihood of AD and an increased likelihood of no cognitive impairment (NCI) [PMC9054681].
-CA G -GU uu aguac AAGUGCUCAUA UGCAG AGuu g ||||| ||||||||||| ||||| |||| g ucauG UUCACGGGUAU AUGUC ucag c ACC G Auc ua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001413 |
Description | Homo sapiens hsa-miR-20b-5p mature miRNA |
Sequence | 6 - CAAAGUGCUCAUAGUGCAGGUAG - 28 |
Evidence |
experimental
array-cloned [2], cloned [3-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004752 |
Description | Homo sapiens hsa-miR-20b-3p mature miRNA |
Sequence | 44 - ACUGUAGUAUGGGCACUUCCAG - 65 |
Evidence |
experimental
cloned [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|