miRBase entry: hsa-mir-18b

Stem-loop hsa-mir-18b


Accession
MI0001518
Symbol
HGNC: MIR18B
Description
Homo sapiens hsa-mir-18b precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR18B is a microRNA implicated in various biological processes and diseases, including cancer and systematic diseases like PCOS [PMC3544584]. In PCOS, a condition affecting women's reproductive and metabolic systems, MIR18B is among the microRNAs that are upregulated in the follicular fluid, suggesting its potential role in the pathophysiology of the disease [PMC6956659]. Additionally, MIR18B has been identified as a regulator of the MDM2-p53 pathway, which is crucial for cell cycle control and apoptosis [PMC9791775]. Its expression has been documented as a significant cell cycle regulator in a cyclin-independent manner [PMC9555085], and it is part of a human cluster of miRNAs that includes MIR363, MIR19A2, MIR19B2, MIR20B, and MIR106A [PMC3576234]. In inflammatory conditions and among centenarians, its expression remains poorly characterized [PMC7432402], while it also appears to regulate cell cycle proteins independently of cyclins [PMC6096428]. In cancer contexts like triple-negative breast cancer (TNBC), under-expression of MIR18B has been observed in urine samples compared to healthy controls [PMC9864244], while its expression disorders have been proposed as part of a new prognostic index for mantle cell lymphoma (MCL) known as MIPI-B-miR prognosticator [PMC6183594]. Furthermore, it has been associated with good prognosis in nasopharyngeal carcinoma (NPC) patients when downregulated [PMC6368411], indicating its diverse roles across different conditions.

Literature search
106 open access papers mention hsa-mir-18b
(268 sentences)

Sequence

234541 reads, 1926 reads per million, 99 experiments
uguguUAAGGUGCAUCUAGUGCAGUUAGugaagcagcuuagaaucuacUGCCCUAAAUGCCCCUUCUGGCa
(((...((((.((((.(((.(((((.((................))))))).))).)))).))))...)))

Structure
   guU    U    C   U     U  ugaagca 
ugu   AAGG GCAU UAG GCAGU AG       g
|||   |||| |||| ||| ||||| ||        
aCG   UUCC CGUA AUC CGUca uc       c
   GUC    C    A   C     -  uaagauu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 134170041-134170111 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-18b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-18b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-18b-5p

Accession MIMAT0001412
Description Homo sapiens hsa-miR-18b-5p mature miRNA
Sequence 6 - UAAGGUGCAUCUAGUGCAGUUAG - 28
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-18b-3p

Accession MIMAT0004751
Description Homo sapiens hsa-miR-18b-3p mature miRNA
Sequence 49 - UGCCCUAAAUGCCCCUUCUGGC - 70
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15944709
    c-Myc-regulated microRNAs modulate E2F1 expression
    "O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT"
    "Nature (2005) 435:839-843