Stem-loop mmu-mir-16-1

Accession

MI0000565

Symbol

MGI: Mir16-1

Description

Mus musculus mmu-mir-16-1 precursor miRNA mir-15

Gene
family

RF00455; mir-15

Literature search

284 open access papers mention mmu-mir-16-1
(1810 sentences)

Sequence

1773980 reads, 5970 reads per million, 107 experiments

augucagcggugccuUAGCAGCACGUAAAUAUUGGCGuuaagauucugaaauuaccuCCAGUAUUGACUGUGCUGCUGAaguaagguuggcaa
.(((((((..(((.((((((((((((.((((((((.(.(((..........))).).)))))))).)).)))))))))).)))..))))))).

Structure

a       gg   c          -  A        C u   gauu 
 ugucagc  ugc uUAGCAGCAC GU AAUAUUGG G uaa    c
 |||||||  ||| |||||||||| || |||||||| | |||     
 acgguug  aug AGUCGUCGUG CA UUAUGACC c auu    u
a       ga   a          U  G        u c   aaag 

Annotation confidence High

Genome context

chr14: 61631880-61631972 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-16-1

Mature mmu-miR-16-5p

• Accession: MIMAT0000527
• Description: Mus musculus mmu-miR-16-5p mature miRNA
• Sequence: 16 - UAGCAGCACGUAAAUAUUGGCG - 37
• Evidence: experimental ; cloned [1-2,4-5], Northern [2], Illumina [6,8]

Mature mmu-miR-16-1-3p

• Accession: MIMAT0004625
• Description: Mus musculus mmu-miR-16-1-3p mature miRNA
• Sequence: 58 - CCAGUAUUGACUGUGCUGCUGA - 79
• Evidence: experimental ; cloned [5], Illumina [6-7]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


5. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


6. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


7. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009