miRBase entry: mmu-mir-16-1

Stem-loop mmu-mir-16-1


Accession
MI0000565
Symbol
MGI: Mir16-1
Description
Mus musculus mmu-mir-16-1 precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Literature search
284 open access papers mention mmu-mir-16-1
(1810 sentences)

Sequence

1773980 reads, 5970 reads per million, 107 experiments
augucagcggugccuUAGCAGCACGUAAAUAUUGGCGuuaagauucugaaauuaccuCCAGUAUUGACUGUGCUGCUGAaguaagguuggcaa
.(((((((..(((.((((((((((((.((((((((.(.(((..........))).).)))))))).)).)))))))))).)))..))))))).

Structure
a       gg   c          -  A        C u   gauu 
 ugucagc  ugc uUAGCAGCAC GU AAUAUUGG G uaa    c
 |||||||  ||| |||||||||| || |||||||| | |||     
 acgguug  aug AGUCGUCGUG CA UUAUGACC c auu    u
a       ga   a          U  G        u c   aaag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 61631880-61631972 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-16-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-16-5p

Accession MIMAT0000527
Description Mus musculus mmu-miR-16-5p mature miRNA
Sequence 16 - UAGCAGCACGUAAAUAUUGGCG - 37
Evidence experimental
cloned [1-2,4-5], Northern [2], Illumina [6,8]
Database links
Predicted targets

Mature mmu-miR-16-1-3p

Accession MIMAT0004625
Description Mus musculus mmu-miR-16-1-3p mature miRNA
Sequence 58 - CCAGUAUUGACUGUGCUGCUGA - 79
Evidence experimental
cloned [5], Illumina [6-7]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009