Stem-loop hsa-mir-152

Accession

MI0000462

Symbol

HGNC: MIR152

Description

Homo sapiens hsa-mir-152 precursor miRNA mir-148

Gene
family

RF00248; mir-148

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR152 is a microRNA whose expression levels were observed to return to control levels in cells exposed to lipopolysaccharide (LPS) when treated with MK1903, as opposed to cells treated with LPS alone or the vehicle (veh) group [PMC9994484]. This suggests that MK1903 may have a regulatory effect on MIR152 expression in the context of LPS exposure. Additionally, MIR152 is implicated in liver epithelial-to-mesenchymal transition (EMT) as it can be competitively bound by the long non-coding RNA plasmacytoma variant translocation 1 (PVT1), which indicates a potential role for MIR152 in liver EMT processes [PMC8990740].

Literature search

146 open access papers mention hsa-mir-152
(888 sentences)

Sequence

277009 reads, 813 reads per million, 150 experiments

ugucccccccggcccAGGUUCUGUGAUACACUCCGACUcgggcucuggagcagUCAGUGCAUGACAGAACUUGGgcccggaaggacc
.((((..((.((((((((((((((.((.((((..((((...(((....))))))))))).)).)))))))))))))).))..)))).

Structure

u    cc  c              G  A    CC    cgg   c 
 gucc  cc ggcccAGGUUCUGU AU CACU  GACU   gcu u
 ||||  || |||||||||||||| || ||||  ||||   |||  
 cagg  gg ccgGGUUCAAGACA UA GUGA  CUga   cga g
c    aa  c              G  C    --    ---   g 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

chr17: 48037161-48037247 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-152

Disease association

hsa-mir-152 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-152-3p

• Accession: MIMAT0000438
• Description: Homo sapiens hsa-miR-152-3p mature miRNA
• Sequence: 54 - UCAGUGCAUGACAGAACUUGG - 74
• Evidence: experimental ; cloned [2-3], Illumina [4-5]

Mature hsa-miR-152-5p

• Accession: MIMAT0026479
• Description: Homo sapiens hsa-miR-152-5p mature miRNA
• Sequence: 16 - AGGUUCUGUGAUACACUCCGACU - 38
• Evidence: experimental ; Illumina [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 20158877
   Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
   Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
   BMC Genomics (2010) 11:S6


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


5. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45