miRBase entry: hsa-mir-224

Stem-loop hsa-mir-224


Accession
MI0000301
Symbol
HGNC: MIR224
Description
Homo sapiens hsa-mir-224 precursor miRNA mir-224
Gene
family?
RF00680; mir-224

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR224 is a microRNA that plays a significant role in various biological processes and has been linked to diseases such as cancer and autoimmune disorders [PMC5351619]. Its expression increases when Cx43 is reduced in siAQP4 treated animals, suggesting a regulatory relationship [PMC5843607]. Estradiol is a crucial regulator of MIR224, which has implications for esophageal adenocarcinoma and esophageal squamous cell carcinoma [PMC6609598]. MIR224 is also considered a potential biomarker for esophageal adenocarcinoma, as indicated by its association with the disease [PMC6609598]. In pancreatic adenocarcinoma, MIR224 is involved in disease progression, and in ovarian cancer, it contributes to chemoresistance by affecting the PRKCD pathway [PMC6005310; PMC8071157].. In colorectal cancer, MIR224 targets genes such as glycine methyltransferases and is involved in the epithelial-mesenchymal transition by interacting with the Smad7/TGFβ pathway [PMC9775527; PMC5240405].. It has been identified as an overexpressed prognostic marker in colorectal cancer and WNT medulloblastomas [PMC5935085; PMC4333163].. MIR224's interaction with Smad4 and HOXD10 promotes cell migration in hepatocellular carcinoma and colorectal cancer, and it also regulates natural killer cell function by modulating NCR1 transcript levels [PMC5226496; PMC9166526].. Dysregulation of MIR224 is linked to the loss of cell cycle control in hepatocellular carcinoma and to changes in angiogenesis following a stroke [PMC6271763; PMC6732937]..

Literature search
123 open access papers mention hsa-mir-224
(843 sentences)

Sequence

19600 reads, 734 reads per million, 116 experiments
gggcuuUCAAGUCACUAGUGGUUCCGUUUAGuagaugauugugcauuguuucAAAAUGGUGCCCUAGUGACUACAaagccc
(((((((..(((((((((.(((.((((((.(.(((((((.....)))))))).)))))).))))))))))))..)))))))

Structure
       CA         U   U      A u       u 
gggcuuU  AGUCACUAG GGU CCGUUU G agaugau g
|||||||  ||||||||| ||| |||||| | ||||||| u
cccgaaA  UCAGUGAUC CCG GGUAAA c uuuguua g
       CA         -   U      A -       c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 151958578-151958658 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-224
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-224 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-224 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-224 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-224-5p

Accession MIMAT0000281
Description Homo sapiens hsa-miR-224-5p mature miRNA
Sequence 7 - UCAAGUCACUAGUGGUUCCGUUUAG - 31
Evidence experimental
cloned [1-4]
Database links
Predicted targets

Mature hsa-miR-224-3p

Accession MIMAT0009198
Description Homo sapiens hsa-miR-224-3p mature miRNA
Sequence 53 - AAAAUGGUGCCCUAGUGACUACA - 75
Evidence experimental
qRT-PCR [5], 454 [6]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 19015728
    MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells
    Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E
    PLoS One (2008) 3:e3726

  5. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  6. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706