MIR148A is a microRNA that has been studied for its role in protein regulation and target identification in cell lines, but it was found to have minimal protein regulation and no identified protein targets [PMC10057657]. The liver detargeting effects of MIR148A are not only due to its binding to target sites, but also because other members of the MIR148/152 family, such as miR-148b and miR-152, can recognize MIR148A target sites and downregulate transgenes [PMC4467430]. The effects of psychotropics on various miRNAs, including MIR148A, as well as on the REST gene, should be studied in Huntington's disease models [PMC3856079]. DNMT1 is a predicted target of MIR148A and its expression is elevated in adipocytes of obese individuals [PMC6817687]. Dysregulated expression of several miRNAs, including MIR148A, has been found in immune cells from patients with lupus and is associated with dysregulated inflammatory function [PMC7139533]. MIR148A is a microRNA that has minimal protein regulation and no identified protein targets in cell lines [PMC10057657]. It can be detargeted by other members of the MIR148/152 family such as miR-148b and miR-152 [PMC4467430]. The effects of psychotropics on various miRNAs including MIR148A should be studied in Huntington's disease models [PMC3856079]. DNMT1 is a predicted target for MIR148A and its expression is elevated in adipocytes of obese individuals [PMC6817687]. Dysregulated expression of several miRNAs including MIR148A has been found in immune cells from patients with lupus associated with dysregulated inflammatory function.
- -A CC - ag gaggcAAAGUUCUG AG CACU GACU cug u |||||||||||||| || |||| |||| ||| a cucUGUUUCAAGAC UC GUGA CUga gau u A AC -- a ag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004549 |
Description | Homo sapiens hsa-miR-148a-5p mature miRNA |
Sequence | 6 - AAAGUUCUGAGACACUCCGACU - 27 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000243 |
Description | Homo sapiens hsa-miR-148a-3p mature miRNA |
Sequence | 44 - UCAGUGCACUACAGAACUUUGU - 65 |
Evidence |
experimental
cloned [1-3], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|