miRBase entry: hsa-mir-16-2

Stem-loop hsa-mir-16-2


Accession
MI0000115
Symbol
HGNC: MIR16-2
Description
Homo sapiens hsa-mir-16-2 precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR16-2 is a precursor microRNA located on the intronic region of the Structural Maintenance of Chromosomes 4 (SMC4) on chromosome 3, which is involved in the maturation of miR16-5p [PMC9553902]. It is one of the ten microRNAs with the highest absolute amount, indicating its significant presence in cellular processes [PMC8010072]. The expression of MIR16-2 can be influenced by R-2HG/ERα, which has been shown to decrease miR16-5p expression at the transcriptional level, with potential estrogen response elements (EREs) identified on its promoter region [PMC8479483]. In a study observing gene expression over time, MIR16-2 was found to be upregulated with a fold change of 4.54 [PMC8407676]. Additionally, its levels in fibroblasts are notably high during the S phase but decrease as cells progress through G2M and G1 phases [PMC8713755]. In cancer research, an inverse relationship has been observed between MIR16-2 and oncogenes; for instance, lung cancer's overexpression of BCL2 has been linked to underexpression of MIR15A and MIR16 family members including MIR16-1 and MIR16-2 [PMC2683874].

Literature search
682 open access papers mention hsa-mir-16-2
(3207 sentences)

Sequence

2322798 reads, 8136 reads per million, 146 experiments
guuccacucUAGCAGCACGUAAAUAUUGGCGuagugaaauauauauuaaacaCCAAUAUUACUGUGCUGCUUUAgugugac
(((.((((..(((((((((..((((((((.((.................)).))))))))..)))))))))..)))).)))

Structure
   c    cU         UA        C  agugaaa 
guu cacu  AGCAGCACG  AAUAUUGG Gu       u
||| ||||  |||||||||  |||||||| ||       a
cag gugA  UCGUCGUGU  UUAUAACC ca       u
   u    UU         CA        a  aauuaua 


Annotation confidence High
Do you think this miRNA is real?
Comments
This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references [1] and [2].

Genome context
chr3: 160404745-160404825 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-16-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-16-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-16-5p

Accession MIMAT0000069
Description Homo sapiens hsa-miR-16-5p mature miRNA
Sequence 10 - UAGCAGCACGUAAAUAUUGGCG - 31
Evidence experimental
cloned [1,3-4,6-8], Northern [3]
Database links
Predicted targets

Mature hsa-miR-16-2-3p

Accession MIMAT0004518
Description Homo sapiens hsa-miR-16-2-3p mature miRNA
Sequence 53 - CCAAUAUUACUGUGCUGCUUUA - 74
Evidence experimental
cloned [7]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  4. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  5. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  6. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  7. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  8. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540