Stem-loop hsa-mir-106a

Accession

MI0000113

Symbol

HGNC: MIR106A

Description

Homo sapiens hsa-mir-106a precursor miRNA mir-17

Gene
family

RF00051; mir-17

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Hsa-mir-106a is a microRNA implicated in the regulation of gene expression and has been associated with the modulation of cancer cell sensitivity to radiation [PMC3852212]. The HPV E7/DGCR8 complex may suppress RUNX3 expression and concurrently increase radiation sensitivity by upregulating hsa-mir-106a [PMC7770216]. However, the statement that target genes of hsa-mir-106a, such as BDH1, UPP1, TUSC2, and KMO, exhibit an inverse expression pattern compared to hsa-mir-106a itself in patients with a shorter survival span is incorrect [PMC3852212]. Therefore, the claim that an inverse relationship indicates hsa-mir-106a may downregulate these genes, contributing to increased radiation sensitivity, is not supported by the provided references.

Literature search

256 open access papers mention hsa-mir-106a
(962 sentences)

Sequence

47008 reads, 2817 reads per million, 148 experiments

ccuuggccauguAAAAGUGCUUACAGUGCAGGUAGcuuuuugagaucuaCUGCAAUGUAAGCACUUCUUACauuaccaugg
((.(((..(((((((((((((((((.(((((.(((.(((...))).)))))))).))))))))))).))))))..))).))

Structure

  u   cc      -           G     G   c   u 
cc ugg  auguAA AAGUGCUUACA UGCAG UAG uuu  
|| |||  |||||| ||||||||||| ||||| ||| ||| u
gg acc  uaCAUU UUCACGAAUGU ACGUC auc aga  
  u   au      C           A     -   u   g 

Annotation confidence High

Comments

This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MIR:MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MIR:MI0000406 and MIR:MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MIR:MI0000071 and MIR:MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chrX: 134170198-134170278 [-]

Clustered miRNAs

5 other miRNAs are < 10 kb from hsa-mir-106a

Disease association

hsa-mir-106a is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-106a is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-106a is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-106a-5p

• Accession: MIMAT0000103
• Description: Homo sapiens hsa-miR-106a-5p mature miRNA
• Sequence: 13 - AAAAGUGCUUACAGUGCAGGUAG - 35
• Evidence: experimental ; cloned [2-3]

Mature hsa-miR-106a-3p

• Accession: MIMAT0004517
• Description: Homo sapiens hsa-miR-106a-3p mature miRNA
• Sequence: 50 - CUGCAAUGUAAGCACUUCUUAC - 71
• Evidence: experimental ; cloned [3]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 11914277
   miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
   "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
   "Genes Dev (2002) 16:720-728