MIR27A is a microRNA that has been implicated in various biological processes and diseases. Transplantation of lipotoxic HC-exosomal MIR27A has been shown to impair mitochondrial functions and worsen fibrosis in MAFLD [PMC8607138]. In a cellular context, MIR27A, along with other candidate miRs such as miR144, miR153, and miR142-5p, can bind to Nrf2 through multiple distinct binding sites, potentially enhancing the targeting of Nrf2 and its associated functions [PMC3517581]. The influence of variants in MIR27A on the risk of coronary artery disease (CAD) has been evaluated, with rs895819, rs11614913, and rs2168518 variants being investigated [PMC9141586]. MIR27A may also play a role in stem cell and adipocyte differentiation [PMC6158720]. Rosiglitazone treatment was found to decrease the migration of 3T3-L1 preadipocytes compared to MIR27A transfected cells [PMC6158720]. The expression of VEGF and VEGFR1 was evaluated along with key transcription factors (Sp1, Sp3) and microRNAs (miR20a and MIR27A) in response to TA treatment [PMC7168141]. Chloroquine did not affect the processing of miR21 or MIR27A in control cells after pre-treatment [PMC3749859]. In Treg cells with reduced Dicer levels but overexpressed miRNAs such as let-7a, let-7f, miR-16, miR-23a/b, MIR27A, and miR-155 were observed [PMC3072673].
a a A U g u cac cug gg gc GGGCUUAGCUGCU GUGAGCA gg c a ||| || || ||||||||||||| ||||||| || | gac cc CG CUUGAAUCGGUGA CACUUgu cu g c c c C - g - aac
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004501 |
Description | Homo sapiens hsa-miR-27a-5p mature miRNA |
Sequence | 10 - AGGGCUUAGCUGCUUGUGAGCA - 31 |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
Accession | MIMAT0000084 |
Description | Homo sapiens hsa-miR-27a-3p mature miRNA |
Sequence | 51 - UUCACAGUGGCUAAGUUCCGC - 71 |
Evidence |
experimental
cloned [1,3-5], Northern [1] |
Database links | |
Predicted targets |
|