![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-194-1 |
||||||
Accession | MI0000488 (change log) | |||||
Previous IDs | hsa-mir-194 | |||||
Symbol | HGNC:MIR194-1 | |||||
Description | Homo sapiens miR-194-1 stem-loop | |||||
Gene family | MIPF0000055; mir-194 | |||||
Literature search |
![]()
143 open access papers mention hsa-mir-194-1 | |||||
Stem-loop |
a - uu u a g cu gu 5' uggu g aucaag guaacagca cuccau ugga gu a |||| | |||||| ||||||||| |||||| |||| || 3' acca u uaguuu cauugucgu gaggug accu ua c a u gg u a - -u ac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MI0000236) on chromosome 1, and mir-194-2 (MI0000733) on chromosome 19) and human (mir-194-1 (MI0000488) on chromosome 1, and mir-194-2 (MI0000732) on chromosome 11). |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-194-5p |
|
Accession | MIMAT0000460 |
Previous IDs | hsa-miR-194 |
Sequence |
15 - uguaacagcaacuccaugugga - 36 |
Deep sequencing | 215327 reads, 154 experiments |
Evidence | experimental; cloned [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|