MIR194-2 is a miRNA cluster located on chromosome 11q13.1 [PMC6120784]. It is part of the MIR192-194-2 cluster, which has been reported to respond to p53 activation [PMC6120784]. MIR194-1 and MIR194-2, although located on different chromosomes, share an identical mature sequence and target the same type of mRNAs [PMC6120784]. The methylation levels at MIR194-2 were observed using the Mann-Whitney test to compare squamous and Barrett's groups [PMC6120784]. The coexpression of MIR192 and MIR194-2 in Barrett's esophagus (BE) was investigated in relation to genomic and epigenetic alterations [PMC6120784]. In a study on miRNA expression signatures, MIR194-2 was among the top-ranked miRNAs [PMC9284388]. It has also been found to be upregulated in lung cancer and downregulated in epilepsy patients, suggesting its potential as a diagnostic biomarker for these conditions [PMC3143163] [PMC7465068]. Additionally, an SNP in MIR194-2 was shown to be differentially expressed in lung cancer [PMC3143163]. The upregulation of miR194-1 and MIR194-2 demonstrated good diagnostic performance for certain conditions, with AUROC values of 0.946 and 0.940, respectively [PMC6005310]. In patients with focal cortical dysplasia (FCD), exosomal miRNAs including MIR194-2 were found to be upregulated in circulating serum exosomes [PMC7465068]. Overall, these findings highlight the potential role of MIR194-2 as a biomarker for various diseases.
- c cU A G agu c ugguuc cgcccc GUAACAGCA CUCCAU UGGA gcc a |||||| |||||| ||||||||| |||||| |||| ||| accggg gcgggG UAUUGUCGU GGGGUG ACCu ugg c g a UC C - --- u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000460 |
Description | Homo sapiens hsa-miR-194-5p mature miRNA |
Sequence | 15 - UGUAACAGCAACUCCAUGUGGA - 36 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004671 |
Description | Homo sapiens hsa-miR-194-3p mature miRNA |
Sequence | 51 - CCAGUGGGGCUGCUGUUAUCUG - 72 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|