miRBase entry: hsa-mir-194-1

Stem-loop hsa-mir-194-1


Accession
MI0000488
Symbol
HGNC: MIR194-1
Description
Homo sapiens hsa-mir-194-1 precursor miRNA mir-194
Gene
family?
RF00257; mir-194

Literature search
143 open access papers mention hsa-mir-194-1
(1013 sentences)

Sequence

59167 reads, 266 reads per million, 144 experiments
augguguuaucaagUGUAACAGCAACUCCAUGUGGAcuguguaccaauuuccaguggagaugcuguuacuuuugaugguuaccaa
.(((((.(((((((.(((((((((.((((((.((((..((......)).)))))))))).))))))))).)))))))..))))).

Structure
a     -u       U         A      G    cu  gu 
 uggug  uaucaag GUAACAGCA CUCCAU UGGA  gu  a
 |||||  ||||||| ||||||||| |||||| ||||  ||   
 accau  guaguuu cauugucgu gaggug accu  ua  c
a     ug       u         a      -    -u  ac 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MIR:MI0000236) on chromosome 1, and mir-194-2 (MIR:MI0000733) on chromosome 19) and human (mir-194-1 (MIR:MI0000488) on chromosome 1, and mir-194-2 (MIR:MI0000732) on chromosome 11).

Genome context
chr1: 220118157-220118241 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-194-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-194-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-194-5p

Accession MIMAT0000460
Description Homo sapiens hsa-miR-194-5p mature miRNA
Sequence 15 - UGUAACAGCAACUCCAUGUGGA - 36
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179