Stem-loop sequence hsa-mir-124-1

Accession

MI0000443 (change log)

Previous IDs

hsa-mir-124a-1

Symbol

HGNC:MIR124-1

Description

Homo sapiens miR-124-1 stem-loop

Gene family

MIPF0000021; mir-124

Literature search

429 open access papers mention hsa-mir-124-1
(3733 sentences)

Stem-loop

   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 

Deep sequencing

132553 reads, 255 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 9903388-9903472 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR124-1
• HGNC:MIR124-1
• RNAcentral:URS000075A939_9606
• miRBase Tracker:MI0000443

Mature sequence hsa-miR-124-5p

• Accession: MIMAT0004591
• Previous IDs: hsa-miR-124*
• Sequence: 14 - cguguucacagcggaccuugau - 35
• Deep sequencing: 4370 reads, 22 experiments
• Evidence: experimental; cloned [5]
• Predicted targets:
  • TargetMiner:hsa-miR-124-5p
  • TargetScanVert:hsa-miR-124-5p
  • miRDB:hsa-miR-124-5p
  • microrna.org:hsa-miR-124-5p

Mature sequence hsa-miR-124-3p

• Accession: MIMAT0000422
• Previous IDs: hsa-miR-124a;hsa-miR-124
• Sequence: 53 - uaaggcacgcggugaaugccaa - 74
• Deep sequencing: 393261 reads, 104 experiments
• Evidence: experimental; cloned [2,4-5]
• Database links:
  • RNAcentral:URS000020BE6A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-124-3p
  • TargetScanVert:hsa-miR-124-3p.1
  • miRDB:hsa-miR-124-3p
  • microrna.org:hsa-miR-124-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).