MIR124-3 is a conserved microRNA that has been found to inhibit invasion and migration of malignant cells in ovarian cancer and hepatocellular cancer [PMC6712160]. It is one of three members of the Mir124 class, along with Mir124-1 and Mir124-2, located at different genomic positions [PMC6346295]. MIR124-3 has been shown to be hypermethylated in tumor samples, with a 16-fold difference in methylation compared to control samples [PMC8656781]. Hypermethylation of MIR124-3 has also been associated with shorter overall survival in ovarian cancer patients [PMC8835734]. Methylation levels of MIR124-3 have been found to increase significantly in primary ovarian tumors and peritoneal macroscopic metastases compared to control samples [PMC8835734]. Additionally, MIR124-3 methylation has been associated with the onset of ovarian cancer pathogenesis [PMC8835734]. MIR124-3 is one of three genes that encode the same mature miR-124, with the other two genes being MIR124-1 and MIR124-2 [PMC4861808]. It has also been found to be methylated in patients with borderline personality disorder (BPD) [PMC6252387] and is involved in neurogenesis [PMC7686352]. Furthermore, MIR124-3 is one of four microRNA genes identified as having anti-tumor roles in pancreatic ductal adenocarcinoma (PDAC) [PMC9599555]. CpG islands located in the promoters of all three miR-124 precursor genes (MIR124-1, MIR124-2, and MIR 24 - 3) have been selected for analysis due to specific criteria being met. However, it remains unclear whether the upregulation of miR-124 is directly related to the hypomethylation of the precursor genes [PMC8724533].
u - c gC A GA uaaug gagg gcc cucu GUGUUCAC GCG CCUUGAUu u |||| ||| |||| |||||||| ||| |||||||| cucc cgg gagA CGUAAGUG CGC GGAAUuaa c c g a AC G AC cauau
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004591 |
Description | Homo sapiens hsa-miR-124-5p mature miRNA |
Sequence | 15 - CGUGUUCACAGCGGACCUUGAU - 36 |
Evidence |
experimental
cloned [5] |
Accession | MIMAT0000422 |
Description | Homo sapiens hsa-miR-124-3p mature miRNA |
Sequence | 53 - UAAGGCACGCGGUGAAUGCCAA - 74 |
Evidence |
experimental
cloned [2,4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|