![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-181b-1 |
||||||
Accession | MI0000270 (change log) | |||||
Previous IDs | hsa-mir-181b | |||||
Symbol | HGNC:MIR181B1 | |||||
Description | Homo sapiens miR-181b-1 stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Literature search |
![]()
372 open access papers mention hsa-mir-181b-1 | |||||
Stem-loop |
ccugugcagagauuauuuuuuaaaa aucaa cug gaa g 5' ggucaca cauucauug ucgguggguu cu u ||||||| ||||||||| |||||||||| || 3' ccggugu guaaguaac agucacucga gg g -------------------uucgcc -caac --a aca u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-181b-5p |
|
Accession | MIMAT0000257 |
Previous IDs | hsa-miR-181b |
Sequence |
36 - aacauucauugcugucggugggu - 58 |
Deep sequencing | 1387103 reads, 157 experiments |
Evidence | experimental; cloned [3-5] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-181b-3p |
|
Accession | MIMAT0022692 |
Sequence |
76 - cucacugaacaaugaaugcaa - 96 |
Deep sequencing | 1896 reads, 119 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:15800047
"Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
Proc Natl Acad Sci U S A. 102:5570-5575(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|