Stem-loop hsa-mir-181b-2

Accession

MI0000683

Symbol

HGNC: MIR181B2

Description

Homo sapiens hsa-mir-181b-2 precursor miRNA

Literature search

362 open access papers mention hsa-mir-181b-2
(1596 sentences)

Sequence

455041 reads, 807 reads per million, 142 experiments

cugauggcugcacucAACAUUCAUUGCUGUCGGUGGGUuugagucugaaucaaCUCACUGAUCAAUGAAUGCAaacugcggaccaaaca
....((((((((.....(((((((((..(((((((((((.((.......)))))))))))))))))))))).....))))).)))....

Structure

cuga   -     cucAA         CU           u  gu 
    ugg cugca     CAUUCAUUG  GUCGGUGGGUu ga  c
    ||| |||||     |||||||||  ||||||||||| ||  u
    acc ggcgu     GUAAGUAAC  UAGUCACUCaa cu  g
acaa   a     caaAC         --           -  aa 

Annotation confidence High

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [3]. There are two predicted hairpin precursor sequences in the human genome; mir-181b-1 (MIR:MI0000270) is found on chromosome 1 [1], and mir-181b-2 (MIR:MI0000683) on chromosome 9 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chr9: 124693710-124693798 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-181b-2

Disease association

hsa-mir-181b-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-181b-5p

• Accession: MIMAT0000257
• Description: Homo sapiens hsa-miR-181b-5p mature miRNA
• Sequence: 16 - AACAUUCAUUGCUGUCGGUGGGU - 38
• Evidence: experimental ; cloned [3-5]

Mature hsa-miR-181b-2-3p

• Accession: MIMAT0031893
• Description: Homo sapiens hsa-miR-181b-2-3p mature miRNA
• Sequence: 54 - CUCACUGAUCAAUGAAUGCA - 73
• Evidence: not_experimental

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


4. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


5. PubMed ID: 15800047
   Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
   "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
   "Proc Natl Acad Sci U S A (2005) 102:5570-5575