MIR181B1 is a microRNA implicated in various biological processes and diseases, including carcinogenesis and psychiatric disorders [PMC8430834]. It is a critical regulator in KRAS-driven carcinogenesis, particularly in lung cancer (LC) and pancreatic ductal adenocarcinoma (PDAC) [PMC8430834]. MIR181B1 expression is modulated during differentiation, with its suppression observed upon differentiation [PMC4168020]. It has been associated with the onset of manic symptoms in bipolar disorder (BD) and is differentially expressed in schizophrenia patients on antipsychotic medication [PMC6504680]. MIR181B1 expression increases during manic episodes of BD and shows higher expression levels in treatment-resistant schizophrenia patients compared to responsive patients [PMC6504680], [PMC9554663]. However, the statement that MIR181B1 gene expression alterations are linked to regions frequently altered in cancer should be revised, as the reference does not explicitly support this claim for MIR181B1 specifically [PMC7675850], [PMC2683874]. Lastly, the Mir181ab1 cluster, which includes MIR181B1, is necessary for the induction of tumorigenesis by mutant KRAS by regulating cell cycle progression, suggesting a nonredundant function for MIR181B1 alongside miR181a1 in promoting an oncogenic phenotype [PMC7108928].
ccugugcagagauuauuuuuuaaaa aucAA CUG gaac g ggucaca CAUUCAUUG UCGGUGGGUu ugu u ||||||| ||||||||| |||||||||| ||| ccggugu GUAAGUAAC AGUCACUCga aca g -------------------uucgcc -cAAC --A ---- g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000257 |
Description | Homo sapiens hsa-miR-181b-5p mature miRNA |
Sequence | 36 - AACAUUCAUUGCUGUCGGUGGGU - 58 |
Evidence |
experimental
cloned [3-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0022692 |
Description | Homo sapiens hsa-miR-181b-3p mature miRNA |
Sequence | 76 - CUCACUGAACAAUGAAUGCAA - 96 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|