Stem-loop sequence osa-MIR5837

AccessionMI0019858 (change log)
DescriptionOryza sativa miR5837 stem-loop
Stem-loop
   --gaauug        -   ug       c   -aa  - ug  a   c     --  u    agacauucuugaugcuuuccaagccuauagcugua 
5'         gaagggug aug  gagcguu ggc   ug u  ga uga augca  gc ucga                                   c
           |||||||| |||  ||||||| |||   || |  || ||| |||||  || ||||                                   a
3'         uuuuccgc uau  uuugcga ucg   ac a  cu acu ugugu  cg aguu                                   g
   cuguucca        g   gu       u   gua  u gu  c   c     ua  u    ugaaagauucuuuugacguacucuagggagguaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 24702021-24702212 [-]
intergenic
Database links

Mature sequence osa-miR5837.2

Accession MIMAT0023313
Sequence

11 - 

ggugauguggagcguucggca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence osa-miR5837.1

Accession MIMAT0023314
Sequence

32 - 

auguuggaaugacaugcagcu

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).