Stem-loop sequence osa-MIR5831

AccessionMI0019850 (change log)
DescriptionOryza sativa miR5831 stem-loop
Stem-loop
   u     c   u  a     c         a            -      -            a   aaauuu   u    u 
5'  uuggu aaa uu aacua ucuaaguuu acuaauuuuaua aaaaga uaguaauauuuu aau      uca aaua a
    ||||| ||| || ||||| ||||||||| |||||||||||| |||||| |||||||||||| |||      ||| ||||  
3'  aauca uuu ag uugau agauucaaa ugauuaaaauau uuuuuu aucauuauaaaa uug      ggu uuau u
   a     a   c  g     a         c            c      c            a   ------   u    u 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 28577824-28577979 [+]
intergenic
Database links

Mature sequence osa-miR5831

Accession MIMAT0023305
Sequence

123 - 

uagucaaacuuagaauaguuggac

 - 146

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).