Stem-loop sequence osa-MIR5830

AccessionMI0019849 (change log)
DescriptionOryza sativa miR5830 stem-loop
Stem-loop
                       gg            cuuuguuu             auaacauuuuuuuuggacaaaucaucaagacauuuuucuuguuca 
5' aaaaucacacauguagauga  ugauguuacaca        aucauauauaaaa                                             a
   ||||||||||||||||||||  ||||||||||||        |||||||||||||                                             a
3' uuuugguguguacaucuauu  gcuacgaugugu        ugguauauauuuu                                             c
                       au            --------             agaacagauuugaacagaagcaaacacucuauauuuuuauuauuu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 4352437-4352631 [-]
intergenic
Database links

Mature sequence osa-miR5830

Accession MIMAT0023304
Sequence

11 - 

auguagaugaggugauguuacaca

 - 34

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).