Stem-loop sequence osa-MIR5825

AccessionMI0019844 (change log)
DescriptionOryza sativa miR5825 stem-loop
Stem-loop
      cu  -cua       a      au  c     a c           c       c     auuuaacuuaguuuauauaccaaauuaguuuuaugaaaucaauagcugaauau 
5' gug  cc    cguuuua gguuau  ga guuuu a uuugguuaaaa caaacua uucaa                                                     a
   |||  ||    ||||||| ||||||  || ||||| | ||||||||||| ||||||| |||||                                                      
3' cac  gg    gcaaagu ccaaua  cu caaaa u aaaccaguuuu guuugau aaguu                                                     u
      cu  cugg       -      gu  a     c a           a       u     caaacaucuuuuguuauuauuauaaaaguugaguuguauuuaaauaauauuuu 
Get sequence
Deep sequencing
149 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 23591556-23591787 [-]
intergenic
Database links

Mature sequence osa-miR5825

Accession MIMAT0023299
Sequence

199 - 

aaaacaucugauaaccugaaacgg

 - 222

Get sequence
Deep sequencing101 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).