Stem-loop sequence osa-MIR5822

AccessionMI0019840 (change log)
DescriptionOryza sativa miR5822 stem-loop
Literature search

1 open access papers mention osa-MIR5822
(1 sentences)

Stem-loop
          -   u g  ag --      -    cccaaaaa     -    cuuggggacucauaugcacagcagcaugaguaaaauguugcaccuugggagugagag 
5' gccccuu ugc a cu  c  ugagca acag        caagg augu                                                         g
   ||||||| ||| | ||  |  |||||| ||||        ||||| ||||                                                         c
3' uggggag gcg u ga  g  gcucgu uguc        guucc uacg                                                         a
          u   u g  cu ua      c    ----acua     a    uauaacuguuuugacuuaaggccuacggaguguacgaauuaauauaaccuaacguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 26335769-26335976 [+]
intergenic
Database links

Mature sequence osa-miR5822

Accession MIMAT0023295
Sequence

178 - 

ugucugcucgaugucagguug

 - 198

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).