Stem-loop sequence osa-MIR5821

AccessionMI0019839 (change log)
DescriptionOryza sativa miR5821 stem-loop
Stem-loop
        a u   c  a c a      -   -  ug -       cagc      a  c     u a ca   -   gg   -aaa     c aca c  g       cagagcgaca      -      -c       
5' cuggc g gga gg g g uggugg gcg gc  g cgguggg    gggagg ag ggagc g g  gcg gcg  gcg    uggag g   g gg cgguggg          agggcg aagagg  cgguga 
   ||||| | ||| || | | |||||| ||| ||  | |||||||    |||||| || ||||| | |  ||| |||  |||    ||||| |   | || |||||||          |||||| ||||||  ||||| g
3' ggccg c ccu uc c c accgcc cgu ug  c gcuaccc    cccucc uc ccucg c c  cgc cgc  cgc    accuc c   c cc gcuaccc          uuccgc uucucc  gccacc 
        - -   u  - - a      a   g  gu a       ---a      c  u     - - ac   g   aa   ggcc     u --c a  g       ----------      c      uc       
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 24605427-24605673 [+]
intergenic
Database links

Mature sequence osa-miR5821

Accession MIMAT0023294
Sequence

8 - 

uggacggagcgauggugggcg

 - 28

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).