Stem-loop sequence osa-MIR5820

AccessionMI0019838 (change log)
DescriptionOryza sativa miR5820 stem-loop
Stem-loop
         ugaacu   a    ua    ---        a  u   u 
5' ggaaau      uaa uccu  aucg   uuugcuag uu uuc u
   ||||||      ||| ||||  ||||   |||||||| || |||  
3' ccuuua      guu agga  uagu   agacgguc ag gag g
         -----u   a    gc    uag        c  u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 13982605-13982688 [+]
intergenic
Database links

Mature sequence osa-miR5820

Accession MIMAT0023293
Sequence

54 - 

uggcagagauugaucgaggaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).