Stem-loop sequence osa-MIR5819

AccessionMI0019837 (change log)
DescriptionOryza sativa miR5819 stem-loop
Stem-loop
   u     u a  g      g  aa     g   u 
5'  ggcaa g ga gacgag gg  cggcg cgg g
    ||||| | || |||||| ||  ||||| |||  
3'  ccguu c cu cugcuc uc  gucgc gcc g
   u     - -  g      g  --     -   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 29695842-29695904 [+]
intergenic
Database links

Mature sequence osa-miR5819

Accession MIMAT0023292
Sequence

11 - 

aggacgaggggaacggcggcg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).