Stem-loop sequence osa-MIR5814

AccessionMI0019831 (change log)
DescriptionOryza sativa miR5814 stem-loop
Stem-loop
     c        a            c a       ug      -a    u  cc 
5' gg uacuggua ucaaguuaggaa c ugcaagu  uuuaug  guug gc  u
   || |||||||| |||||||||||| | |||||||  ||||||  |||| ||  c
3' cc gugaccgu aguucaaucuuu g acguuca  agauac  cgau cg  u
     u        g            a a       gu      cg    c  ug 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 26661349-26661456 [-]
intergenic
Database links

Mature sequence osa-miR5814

Accession MIMAT0023286
Sequence

11 - 

aaucaaguuaggaaccaugcaagu

 - 34

Get sequence
Deep sequencing23 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).