Stem-loop sequence osa-MIR5813

AccessionMI0019830 (change log)
DescriptionOryza sativa miR5813 stem-loop
Stem-loop
   u   gag       u         -   a              ag    auuauggguuaccgugcca 
5'  ggu   cuaauuu caugaccag guc cugcuugccuuugc  uacc                   g
    |||   ||||||| ||||||||| ||| ||||||||||||||  ||||                   a
3'  ccg   gguuaag guacugguc cag gacgaacggaaacg  augg                   u
   a   --a       -         u   c              aa    gaaaaguaaggaagggagu 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 9952990-9953124 [-]
intergenic
Database links

Mature sequence osa-miR5813

Accession MIMAT0023285
Sequence

104 - 

aagcagcgacucuggucaugga

 - 125

Get sequence
Deep sequencing29 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).