Stem-loop sequence osa-MIR5811

AccessionMI0019828 (change log)
DescriptionOryza sativa miR5811 stem-loop
Stem-loop
              c             c           a 
5' aaaaaaaaaac uaaccuaggaguu gaugggacaua g
   ||||||||||| ||||||||||||| |||||||||||  
3' uuuuuuuuuug auuggaucuucaa cuacucuguau a
              -             c           u 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 13197994-13198070 [-]
intergenic
Database links

Mature sequence osa-miR5811

Accession MIMAT0023283
Sequence

11 - 

ccuaaccuaggaguucgaugggac

 - 34

Get sequence
Deep sequencing21 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).