Stem-loop sequence osa-MIR5801b

AccessionMI0019825 (change log)
DescriptionOryza sativa miR5801b stem-loop
Stem-loop
           c     ug              cug    ag 
5' uacuaaau guuuc  aucguuggauuuag   gaua  a
   |||||||| |||||  ||||||||||||||   ||||  u
3' augguuua caaag  uagcgaccuagguu   uuau  a
           a     gu              --a    gu 
Get sequence
Deep sequencing
394 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 18739255-18739333 [+]
intergenic
Database links

Mature sequence osa-miR5801b

Accession MIMAT0023280
Sequence

2 - 

acuaaaucguuucugaucguugga

 - 25

Get sequence
Deep sequencing368 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).