Stem-loop sequence osa-MIR5804

AccessionMI0019820 (change log)
DescriptionOryza sativa miR5804 stem-loop
Stem-loop
   ga        ca              c           cc  ugc   -     ucaucc      c 
5'   ucagauug  ucggcaucucuacu ugcagccgcug  uc   cgc cucuu      gcuguc g
     ||||||||  |||||||||||||| |||||||||||  ||   ||| |||||      |||||| u
3'   agucuagu  agccguagagauga gcgucggcgac  ag   gug gagaa      cggcag g
   cg        uc              a           --  -uu   a     ------      c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 20810160-20810286 [-]
intergenic
Database links

Mature sequence osa-miR5804

Accession MIMAT0023275
Sequence

97 - 

ugcgaaguagagaugccgacu

 - 117

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).