Stem-loop sequence osa-MIR5803

AccessionMI0019819 (change log)
DescriptionOryza sativa miR5803 stem-loop
Stem-loop
   -           c  c     a    ---     u ag   aua 
5'  uaauguuacua ca uguag cgcu   acgug g  aua   g
    ||||||||||| || ||||| ||||   ||||| |  |||   g
3'  auuacagugau gu auguc gcga   ugcac c  uau   a
   u           a  a     c    cua     c aa   agg 
Get sequence
Deep sequencing
34 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 30231534-30231620 [+]
intergenic
Database links

Mature sequence osa-miR5803

Accession MIMAT0023274
Sequence

11 - 

accacuguagacgcuacgugugag

 - 34

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).