Stem-loop sequence osa-MIR5801a

AccessionMI0019815 (change log)
DescriptionOryza sativa miR5801a stem-loop
Stem-loop
        a       u               gauu   cu    
5' ucacg uaccaaa cguuuucgaucguug    auc  gcc 
   ||||| ||||||| |||||||||||||||    |||  || g
3' agugu augguuu gcaaaagcuagcaac    uag  cga 
        c       u               ----   au    
Get sequence
Deep sequencing
675 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 19318211-19318289 [-]
intergenic
Database links

Mature sequence osa-miR5801a

Accession MIMAT0023270
Sequence

8 - 

accaaaucguuuucgaucguugga

 - 31

Get sequence
Deep sequencing673 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).